ID: 1065030282_1065030286

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1065030282 1065030286
Species Human (GRCh38) Human (GRCh38)
Location 10:21579086-21579108 10:21579101-21579123
Sequence CCTATTTCATCTTTATTTTTGAA TTTTTGAAGGGCATTGTGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 167, 4: 1499} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!