ID: 1065053051_1065053053

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1065053051 1065053053
Species Human (GRCh38) Human (GRCh38)
Location 10:21815479-21815501 10:21815514-21815536
Sequence CCTCTATCTCTGACACAGGAGTT CCAGCAGTATCTATGAAACTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 34, 4: 224} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!