ID: 1065124418_1065124422

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1065124418 1065124422
Species Human (GRCh38) Human (GRCh38)
Location 10:22560293-22560315 10:22560326-22560348
Sequence CCAGAAGGATACGCTGCTGTGCT GTTTGGGGAGCCCGCCGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 300} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!