ID: 1065173672_1065173678

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1065173672 1065173678
Species Human (GRCh38) Human (GRCh38)
Location 10:23056403-23056425 10:23056447-23056469
Sequence CCTGAGTACAATAAAATACTGTA TCCCATGGCTGGAGTCATGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 240} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!