ID: 1065239893_1065239909

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1065239893 1065239909
Species Human (GRCh38) Human (GRCh38)
Location 10:23694831-23694853 10:23694879-23694901
Sequence CCACTGTCACGCTACCCGCCCGC GAATTGAAAGTCGTTTCCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 48} {0: 1, 1: 0, 2: 0, 3: 1, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!