ID: 1065278349_1065278354

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1065278349 1065278354
Species Human (GRCh38) Human (GRCh38)
Location 10:24109079-24109101 10:24109116-24109138
Sequence CCTCAGGCTCCCAAAGTGTTGGT CTACCGTGCCTGGCCAAGACTGG
Strand - +
Off-target summary {0: 3, 1: 189, 2: 9868, 3: 114757, 4: 234691} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!