ID: 1065278352_1065278354

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1065278352 1065278354
Species Human (GRCh38) Human (GRCh38)
Location 10:24109089-24109111 10:24109116-24109138
Sequence CCAAAGTGTTGGTATTACAGGCA CTACCGTGCCTGGCCAAGACTGG
Strand - +
Off-target summary {0: 96, 1: 8829, 2: 117498, 3: 250279, 4: 238935} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!