ID: 1065374756_1065374757

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1065374756 1065374757
Species Human (GRCh38) Human (GRCh38)
Location 10:25027459-25027481 10:25027492-25027514
Sequence CCTGGGAGATGCAGGTTGCGGTT TGCGCCGTTGCACTCCAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 180, 3: 5775, 4: 52817} {0: 102, 1: 5780, 2: 46384, 3: 153060, 4: 222491}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!