ID: 1065374756_1065374758

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1065374756 1065374758
Species Human (GRCh38) Human (GRCh38)
Location 10:25027459-25027481 10:25027493-25027515
Sequence CCTGGGAGATGCAGGTTGCGGTT GCGCCGTTGCACTCCAGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 180, 3: 5775, 4: 52817} {0: 263, 1: 14063, 2: 99752, 3: 221077, 4: 218082}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!