ID: 1065428341_1065428345

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1065428341 1065428345
Species Human (GRCh38) Human (GRCh38)
Location 10:25628786-25628808 10:25628806-25628828
Sequence CCGAGGATGATGGCCTCCACCTC CTCCATCTGTGTTGCTGCAAAGG
Strand - +
Off-target summary No data {0: 21, 1: 158, 2: 956, 3: 3011, 4: 5887}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!