ID: 1065775519_1065775524

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1065775519 1065775524
Species Human (GRCh38) Human (GRCh38)
Location 10:29116001-29116023 10:29116039-29116061
Sequence CCGGCCACCAGAATCGTGAGCCA TTTATAAATTACCCAGCCTCAGG
Strand - +
Off-target summary {0: 4, 1: 38, 2: 174, 3: 628, 4: 1827} {0: 782, 1: 8120, 2: 14095, 3: 13596, 4: 10262}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!