|
Left Crispr |
Right Crispr |
| Crispr ID |
1065775522 |
1065775524 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
10:29116021-29116043
|
10:29116039-29116061
|
| Sequence |
CCAAATAAACCTCTTTTCTTTAT |
TTTATAAATTACCCAGCCTCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 552, 1: 2956, 2: 4166, 3: 3533, 4: 4128} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|