ID: 1065813889_1065813900

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1065813889 1065813900
Species Human (GRCh38) Human (GRCh38)
Location 10:29467380-29467402 10:29467425-29467447
Sequence CCTGGAAGGTGGCTTGGTCCCCG CCAGTGAGAATTTGAAGTCCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!