ID: 1065841477_1065841486

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1065841477 1065841486
Species Human (GRCh38) Human (GRCh38)
Location 10:29704842-29704864 10:29704860-29704882
Sequence CCTCTCAGGAGTCCTGGGGATTT GATTTTCAGGGGGTTGGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 207} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!