ID: 1066220839_1066220849

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1066220839 1066220849
Species Human (GRCh38) Human (GRCh38)
Location 10:33335426-33335448 10:33335466-33335488
Sequence CCAGAGCTGGAGGGCGAGGAGGG GGGAGCCGCACCGCGAAGCCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 60, 4: 435} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!