ID: 1066258491_1066258496

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1066258491 1066258496
Species Human (GRCh38) Human (GRCh38)
Location 10:33705218-33705240 10:33705232-33705254
Sequence CCTCTAGTATTATAAGATCAGGG AGATCAGGGGACTGGTGGCCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!