ID: 1066265043_1066265049

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1066265043 1066265049
Species Human (GRCh38) Human (GRCh38)
Location 10:33768650-33768672 10:33768665-33768687
Sequence CCTGTAATCCCAACACTGTGGGA CTGTGGGAGGCCAAGGTGGACGG
Strand - +
Off-target summary {0: 220, 1: 25162, 2: 322820, 3: 254378, 4: 134308} {0: 14, 1: 1357, 2: 26592, 3: 81400, 4: 160198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!