|
Left Crispr |
Right Crispr |
| Crispr ID |
1066265043 |
1066265049 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
10:33768650-33768672
|
10:33768665-33768687
|
| Sequence |
CCTGTAATCCCAACACTGTGGGA |
CTGTGGGAGGCCAAGGTGGACGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 220, 1: 25162, 2: 322820, 3: 254378, 4: 134308} |
{0: 14, 1: 1357, 2: 26592, 3: 81400, 4: 160198} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|