ID: 1066437332_1066437354

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1066437332 1066437354
Species Human (GRCh38) Human (GRCh38)
Location 10:35406784-35406806 10:35406834-35406856
Sequence CCTCACTTCCCAGTAGGGGCGGC ATGGGGCGGCTGGCCGGGCGGGG
Strand - +
Off-target summary {0: 3201, 1: 1056, 2: 1073, 3: 6945, 4: 7443} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!