ID: 1066437368_1066437379

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1066437368 1066437379
Species Human (GRCh38) Human (GRCh38)
Location 10:35406870-35406892 10:35406888-35406910
Sequence CCACCTCCGTCCCCGTCGGGGCG GGGCGGCCGGCCAGGCAGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 48, 3: 4016, 4: 3547} {0: 15, 1: 198, 2: 1740, 3: 899, 4: 1564}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!