ID: 1066437368_1066437384

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1066437368 1066437384
Species Human (GRCh38) Human (GRCh38)
Location 10:35406870-35406892 10:35406915-35406937
Sequence CCACCTCCGTCCCCGTCGGGGCG TTGGAGCTTTTTCTAATGTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 48, 3: 4016, 4: 3547} {0: 36, 1: 23, 2: 59, 3: 538, 4: 376}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!