ID: 1066437375_1066437381

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1066437375 1066437381
Species Human (GRCh38) Human (GRCh38)
Location 10:35406881-35406903 10:35406896-35406918
Sequence CCCGTCGGGGCGGCCGGCCAGGC GGCCAGGCAGAGGGGCTTTTTGG
Strand - +
Off-target summary {0: 4, 1: 13, 2: 693, 3: 5588, 4: 7319} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!