ID: 1066478991_1066478993 |
View in Genome Browser |
Spacer: 2 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1066478991 | 1066478993 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 10:35777248-35777270 | 10:35777273-35777295 |
| Sequence | CCACATGCTGTTGGAAAAATGGT | CAAGATGCTTGCTTGATGCAGGG |
| Strand | - | + |
| Off-target summary | {0: 6, 1: 12, 2: 12, 3: 31, 4: 202} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||