ID: 1066740433_1066740441

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1066740433 1066740441
Species Human (GRCh38) Human (GRCh38)
Location 10:38514695-38514717 10:38514740-38514762
Sequence CCGAATGGAATGAATTGTAATGG TGGAATGGAATGGAATGGAATGG
Strand - +
Off-target summary No data {0: 12039, 1: 21879, 2: 40950, 3: 55555, 4: 61440}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!