ID: 1067019828_1067019831

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1067019828 1067019831
Species Human (GRCh38) Human (GRCh38)
Location 10:42785573-42785595 10:42785607-42785629
Sequence CCTCCAAAAGTTGGAAAGAGCAC GCCTCATTCGGAACTTTACCCGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 30, 4: 272} {0: 1, 1: 4, 2: 0, 3: 4, 4: 31}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!