ID: 1067019829_1067019831

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1067019829 1067019831
Species Human (GRCh38) Human (GRCh38)
Location 10:42785576-42785598 10:42785607-42785629
Sequence CCAAAAGTTGGAAAGAGCACTTT GCCTCATTCGGAACTTTACCCGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 21, 4: 898} {0: 1, 1: 4, 2: 0, 3: 4, 4: 31}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!