ID: 1067332955_1067332965

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1067332955 1067332965
Species Human (GRCh38) Human (GRCh38)
Location 10:45338818-45338840 10:45338855-45338877
Sequence CCATTTTTTCCCAAGGAGACCTC GGTAACTGTGCATTGGGGAAAGG
Strand - +
Off-target summary No data {0: 38, 1: 156, 2: 147, 3: 111, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!