ID: 1067332955_1067332966

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1067332955 1067332966
Species Human (GRCh38) Human (GRCh38)
Location 10:45338818-45338840 10:45338856-45338878
Sequence CCATTTTTTCCCAAGGAGACCTC GTAACTGTGCATTGGGGAAAGGG
Strand - +
Off-target summary No data {0: 42, 1: 162, 2: 135, 3: 138, 4: 310}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!