ID: 1067566812_1067566821

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1067566812 1067566821
Species Human (GRCh38) Human (GRCh38)
Location 10:47345596-47345618 10:47345624-47345646
Sequence CCCTGATGTGTCATTGTCCCCCT CCTGCGCTGCAGGTGCTGCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 31, 4: 274}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!