ID: 1067598247_1067598256

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1067598247 1067598256
Species Human (GRCh38) Human (GRCh38)
Location 10:47576115-47576137 10:47576152-47576174
Sequence CCACAGCCAGTTGTGGTAGTATA GCTACTCAGAAGGCTGAGGCAGG
Strand - +
Off-target summary No data {0: 2887, 1: 85071, 2: 182808, 3: 212496, 4: 143787}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!