ID: 1067605765_1067605771

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1067605765 1067605771
Species Human (GRCh38) Human (GRCh38)
Location 10:47661106-47661128 10:47661138-47661160
Sequence CCATGGTTTTTAGTTTCTGTCTG GTGGAAAGGAGGGATGAGGAAGG
Strand - +
Off-target summary {0: 4, 1: 66, 2: 70, 3: 61, 4: 495} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!