ID: 1067667036_1067667046

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1067667036 1067667046
Species Human (GRCh38) Human (GRCh38)
Location 10:48287744-48287766 10:48287778-48287800
Sequence CCCGCTCCCAGGTTTCAAATCTG GCCTGGGTAGTTATTGAAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 204} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!