ID: 1067693538_1067693548

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1067693538 1067693548
Species Human (GRCh38) Human (GRCh38)
Location 10:48519708-48519730 10:48519738-48519760
Sequence CCACCTGCCCAGGCTCGACTGCC CCATTTGATGGCATCTTGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 619} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!