ID: 1067693541_1067693548

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1067693541 1067693548
Species Human (GRCh38) Human (GRCh38)
Location 10:48519715-48519737 10:48519738-48519760
Sequence CCCAGGCTCGACTGCCCTCAGGC CCATTTGATGGCATCTTGAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 11, 4: 203} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!