ID: 1067750024_1067750029

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1067750024 1067750029
Species Human (GRCh38) Human (GRCh38)
Location 10:48965329-48965351 10:48965369-48965391
Sequence CCCCAAGTGTCCCAGTCTGAAGA GACTCCATGCTGCTCCTGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 145} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!