ID: 1067906288_1067906296

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1067906288 1067906296
Species Human (GRCh38) Human (GRCh38)
Location 10:50294683-50294705 10:50294722-50294744
Sequence CCAAGAGCCTGGTGATTGCCCTG CCCATTACCACACACACCACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 17, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!