ID: 1067945627_1067945634

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1067945627 1067945634
Species Human (GRCh38) Human (GRCh38)
Location 10:50686481-50686503 10:50686532-50686554
Sequence CCCACAGCTATGATTCCCTTCCC ATGTAGACACAGATTTACATTGG
Strand - +
Off-target summary {0: 7, 1: 0, 2: 2, 3: 19, 4: 168} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!