ID: 1068100545_1068100555

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1068100545 1068100555
Species Human (GRCh38) Human (GRCh38)
Location 10:52547207-52547229 10:52547243-52547265
Sequence CCGTCAGCCCTCCATACCCATGG GGATTCAACCAACCACAGATAGG
Strand - +
Off-target summary No data {0: 1, 1: 7, 2: 10, 3: 26, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!