ID: 1068171825_1068171835

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1068171825 1068171835
Species Human (GRCh38) Human (GRCh38)
Location 10:53404191-53404213 10:53404243-53404265
Sequence CCCTGGAGTGTGGCAGCCACGGT TTCACAGTAATCTGGCCCTCAGG
Strand - +
Off-target summary No data {0: 2, 1: 8, 2: 31, 3: 57, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!