ID: 1068207050_1068207053

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1068207050 1068207053
Species Human (GRCh38) Human (GRCh38)
Location 10:53868974-53868996 10:53868996-53869018
Sequence CCTGGCTAATTCTTTGTAGACAC CAGGGTCTCGCTATGTTGCCTGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 217, 3: 744, 4: 1341} {0: 34, 1: 329, 2: 1824, 3: 5991, 4: 13916}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!