|
Left Crispr |
Right Crispr |
Crispr ID |
1068207050 |
1068207054 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
10:53868974-53868996
|
10:53868997-53869019
|
Sequence |
CCTGGCTAATTCTTTGTAGACAC |
AGGGTCTCGCTATGTTGCCTGGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 7, 2: 217, 3: 744, 4: 1341} |
{0: 56, 1: 1333, 2: 12236, 3: 51917, 4: 133875} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|