ID: 1068564150_1068564151

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1068564150 1068564151
Species Human (GRCh38) Human (GRCh38)
Location 10:58552708-58552730 10:58552721-58552743
Sequence CCTGTTTCTGAAACTATCTAGCC CTATCTAGCCAAGTGATCTTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 9, 3: 57, 4: 345}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!