ID: 1068604512_1068604517

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1068604512 1068604517
Species Human (GRCh38) Human (GRCh38)
Location 10:58990424-58990446 10:58990441-58990463
Sequence CCCCCACTGAGGCACTGTCTAGT TCTAGTGGAGCTGTGAGTAGAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 22, 3: 63, 4: 186} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!