ID: 1068670576_1068670580

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1068670576 1068670580
Species Human (GRCh38) Human (GRCh38)
Location 10:59718474-59718496 10:59718522-59718544
Sequence CCTCAACCAAATCTGTCACTGTG TCCAAGTCTACAGAGAGGTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 200} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!