ID: 1068931446_1068931452

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1068931446 1068931452
Species Human (GRCh38) Human (GRCh38)
Location 10:62594475-62594497 10:62594495-62594517
Sequence CCCACTACCTAGCAGGGTGCCTG CTGGCTCTCGGCTGATGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 113, 4: 599} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!