ID: 1069049638_1069049649

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1069049638 1069049649
Species Human (GRCh38) Human (GRCh38)
Location 10:63778945-63778967 10:63778985-63779007
Sequence CCCACCCCATTATGGAAAAACTG CTCTGGTGCCAAAAAGGTTGGGG
Strand - +
Off-target summary No data {0: 69, 1: 1094, 2: 1639, 3: 1274, 4: 987}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!