ID: 1069049645_1069049651

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1069049645 1069049651
Species Human (GRCh38) Human (GRCh38)
Location 10:63778972-63778994 10:63778996-63779018
Sequence CCACAAAACTGGTCTCTGGTGCC AAAAGGTTGGGGATTCTTGCTGG
Strand - +
Off-target summary {0: 12, 1: 235, 2: 535, 3: 1188, 4: 1464} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!