ID: 1069106114_1069106120

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1069106114 1069106120
Species Human (GRCh38) Human (GRCh38)
Location 10:64385118-64385140 10:64385136-64385158
Sequence CCTTCTTCTCATAGCTCCACTAG ACTAGGCAGTGCTCCAGTGGGGG
Strand - +
Off-target summary {0: 165, 1: 1953, 2: 2073, 3: 1213, 4: 828} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!