ID: 1069106117_1069106121

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1069106117 1069106121
Species Human (GRCh38) Human (GRCh38)
Location 10:64385134-64385156 10:64385147-64385169
Sequence CCACTAGGCAGTGCTCCAGTGGG CTCCAGTGGGGGCTCTGTGTTGG
Strand - +
Off-target summary {0: 54, 1: 751, 2: 1508, 3: 1664, 4: 1505} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!