|
Left Crispr |
Right Crispr |
| Crispr ID |
1069106117 |
1069106122 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
10:64385134-64385156
|
10:64385148-64385170
|
| Sequence |
CCACTAGGCAGTGCTCCAGTGGG |
TCCAGTGGGGGCTCTGTGTTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 54, 1: 751, 2: 1508, 3: 1664, 4: 1505} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|