ID: 1069137383_1069137393

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1069137383 1069137393
Species Human (GRCh38) Human (GRCh38)
Location 10:64782677-64782699 10:64782726-64782748
Sequence CCTTTGGAGATTTCTTTGCTTGT GAGGCTTATCACTAATAGGAAGG
Strand - +
Off-target summary {0: 73, 1: 122, 2: 58, 3: 45, 4: 370} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!